Query (optional)   in Class  

GrainGenes Marker Report: E008

[ Printable Version ]  [ Submit comment/correction ]

Locus
E008
Type
RFLP
Map
Tt-Gill-1D264.8
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuE8
Possible Orthologs
ksue8a
[ Show all 9 ]



Probe for Locus
pTtksuE8
Locus
[ Hide all but 1 of 10 ]
XksuE8-1
XksuE8
HI006G13
D1.1_ctg3225
E008
XksuE8-1D
XksuE8-1B
XksuE8-1A
KSUE8A
KSUE8B
Reference
ReferenceGill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type
Genomic
STS
PCR primers
R:TATGGGCCAGTGATTTCCAC
L:TGCTCGGTTCAATTGACTGC
Specificity
Primer specificity verified, maps on chromosomes 1BL, 1DL.
Linkage Group
1D
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
1.8
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09