Query (optional)   in Class  

GrainGenes Marker Report: E014a

[ Printable Version ]  [ Submit comment/correction ]

Locus
E014a
Type
RFLP
Map
Tt-Gill-3D420
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuE14
Possible Orthologs
E014b
[ Show all 11 ]



Probe for Locus
pTtksuE14
Locus
[ Hide all but 1 of 14 ]
XksuE14-3
XksuE14-6
XksuE14-6D
XksuE14-6B
XksuE14-3D
XksuE14
XksuE14a
XksuE14b
HI002C3
D1.1_ctg9019
E014a
E014b
ksuE14
ksuE14-6D
Type
Genomic
STS
PCR primers
R:GCAGTTACAGGACCAACAGA
L:GAGACCCAGGAGTCCATCAG
Polymorphism
KSUE14 EcoRI
KSUE14 EcoRV
KSUE14 HindIII
KSUE14 XbaI
Linkage Group
6D (2)
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
1.9
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Image
KSUE14 SO autoradiogram
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09