Query (optional)   in Class  

GrainGenes Marker Report: E016

[ Printable Version ]  [ Submit comment/correction ]

Locus
E016
Type
RFLP
Map
Tt-Gill-2D236.4
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuE16
Possible Orthologs
XksuE16
XksuE16-2
XksuE16-2A



Probe for Locus
pTtksuE16
Locus
[ Hide all but 1 of 6 ]
XksuE16
XksuE16-2
XksuE16-2A
HD023M10
D1.1_ctg4343
E016
Type
Genomic
STS
PCR primers
R:CAGACATACATAGATGGAGGC
L:CACCATCGTGCAGATGGAGATC
Specificity
Primer specificity verified, maps on chromosome 2AL.
Polymorphism
[ Hide all but 1 of 6 ]
KSUE16 EcoRV
KSUE16 BamHI
KSUE16 EcoRI
KSUE16 DraI
KSUE16 HindIII
KSUE16 XbaI
Linkage Group
2D
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
1.2
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Image
KSUE16 SO autoradiogram
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09