Query (optional)   in Class  

GrainGenes Marker Report: E006

[ Printable Version ]  [ Submit comment/correction ]

Locus
E006
Type
RFLP
Map
Tt-Gill-4D120.7
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuE6
Possible Orthologs
DGE6
XksuE6



Probe for Locus
pTtksuE6
Locus
DGE6
E006
XksuE6
Reference
ReferenceGill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
General Remarks
Previous PCR_primers R:AATCAAGAAGGACAATGCC, L:TGCAGCATTCTGGAACATGC don't work as well.
Type
Genomic
STS
PCR primers
R:CCAACGAGTACTCCCTCGGC
L:GTATCTCTTCATGCACGTTC
Amplification Conditions
Anneal at 50oC
Linkage Group
4D
Insert Enzyme
PstI
Source Species
Triticum tauschii
Source Tissue
leaf
Insert Size
1.9
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Data Source
Talbert, Luther E.95.07.06
ATMI92.09
Gill, Bikram S.92.09