Query (optional)   in Class  

GrainGenes Marker Report: E009

[ Printable Version ]  [ Submit comment/correction ]

Locus
E009
Type
RFLP
Map
Tt-Gill-4D129.1
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuE9
Possible Orthologs
XksuE9



Probe for Locus
pTtksuE9
Locus
XksuE9-7D
E009
XksuE9
Type
Genomic
STS
PCR primers
R:TTCACAAAATTCACCCAAGC
L:AAATCCAGCGGTATGCATGC
Linkage Group
4D
Insert Enzyme
PstI
Source Species
Triticum tauschii
Insert Size
1.7
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09