Query (optional)   in Class  

GrainGenes Marker Report: E011

[ Printable Version ]  [ Submit comment/correction ]

Locus
E011
Type
RFLP
Map
Tt-Gill-1D325
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuE11
Possible Orthologs
ksuE11
[ Show all 18 ]



Probe for Locus
pTtksuE11
Locus
XksuE11-1
[ Show all 21 ]
Reference
ReferenceGill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type
Genomic
STS
PCR primers
R:CTGTCACTGCTTCCATAACT
L:AAGAAAAGCCTTCAAGACTT
Polymorphism
KSUE11 DraI
Insert Enzyme
PstI
Source Species
Triticum tauschii
Insert Size
2.1
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Image
KSUE11 SO autoradiogram
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09