Query (optional)   in Class  

GrainGenes Marker Report: F008

[ Printable Version ]  [ Submit comment/correction ]

Locus
F008
Type
RFLP
Map
Tt-Gill-4D78.8
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuF8
Possible Orthologs
XksuF8
[ Show all 8 ]



Probe for Locus
pTtksuF8
Locus
[ Hide all but 1 of 9 ]
XksuF8-4A
XksuF8-4D
F008
XksuF8
XksuF8a
XksuF8.2
XksuF8-4B
ksuF8
ksuF8-4D
Type
Genomic
STS
PCR primers
R:GTTCAAGGCAGACCTTGACT
L:GCATTATCATCAGCTGAAAG
Polymorphism
KSUF8 EcoRV
KSUF8 XbaI
KSUF8 EcoRI
KSUF8 HindIII
KSUF8 DraI
Insert Enzyme
PstI
Source Species
Triticum tauschii
Clone Vector
pUC18
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Image
KSUF8 SO autoradiogram
Data Source
Talbert, Luther E.94.09.12
Gill, Bikram S.92.09