Query (optional)   in Class  

GrainGenes Marker Report: F034b

[ Printable Version ]  [ Submit comment/correction ]

Locus
F034b
Type
RFLP
Map
Tt-Gill-7D506.9
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuF34
Possible Orthologs
F034a
ksuF34
XksuF34
XksuF34-3B



Probe for Locus
pTtksuF34
Locus
[ Hide all but 1 of 10 ]
XksuF34-3B
XksuF34
HD004D21
HD019L15
HD016H7
D1.1_ctg3319
D1.1_ctg4902
F034a
F034b
ksuF34
Type
Genomic
STS
PCR primers
R:GCAAAGTAGCAAGCAATCAG
L:AAAGCAGCGAGTCTATGTGT
Linkage Group
3D (2)
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
0.6
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09