Query (optional)   in Class  

GrainGenes Marker Report: F001

[ Printable Version ]  [ Submit comment/correction ]

Locus
F001
Type
RFLP
Map
Tt-Gill-5D574.9
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuF1
Possible Orthologs
XksuF1
[ Show all 6 ]



Probe for Locus
pTtksuF1
Locus
XksuF1-2A
[ Show all 8 ]
Reference
ReferenceGill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type
Genomic
STS
PCR primers
R:CAGTGGTTCACGATAGTAGAT
L:TTGGATAACTTCAGTCAGATG
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
1
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09