Query (optional)   in Class  

GrainGenes Marker Report: F002a

[ Printable Version ]  [ Submit comment/correction ]

Locus
F002a
Type
RFLP
Map
Tt-Gill-2D150.9
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuF2
Possible Orthologs
F002b
[ Show all 16 ]



Probe for Locus
pTtksuF2
Locus
ksuF2A
[ Show all 22 ]
Type
Genomic
STS
PCR primers
R:TTCGCCATTAGAGCAACCTG
L:GGAGATGGATTCCCTTGTCC
Polymorphism
KSUF2 DraI
Linkage Group
2D / 7D (5)
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
0.3
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Image
KSUF2 SO autoradiogram
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09