Query (optional)   in Class  

GrainGenes Marker Report: F011

[ Printable Version ]  [ Submit comment/correction ]

Locus
F011
Type
RFLP
Map
Tt-Gill-2D146.7
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuF11
Possible Orthologs
XksuF11
[ Show all 10 ]



Probe for Locus
pTtksuF11
Locus
XksuF11-2
[ Show all 11 ]
Type
Genomic
STS
PCR primers
R:CCGTATGCTAACGGATAAGC
L:ATGCTGGTCTACGAGTACCT
Specificity
Primer specificity verified, maps on chromosomes 2BL, 2DL.
Polymorphism
KSUF11 XbaI
Insert Enzyme
PstI
Source Species
Triticum tauschii
Clone Vector
pUC18
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Image
KSUF11 SO autoradiogram
Data Source
Talbert, Luther E.94.09.12
Gill, Bikram S.92.09