Query (optional)   in Class  

GrainGenes Marker Report: F019

[ Printable Version ]  [ Submit comment/correction ]

Locus
F019
Type
RFLP
Map
Tt-Gill-6D347.3
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuF19
Possible Orthologs
XksuF19
XksuF19-2D
XksuF19-6B



Probe for Locus
pTtksuF19
Locus
XksuF19-6B
[ Show all 10 ]
Type
Genomic
STS
PCR primers
R:ACTGTTATCTGGAGGTCTCC
L:AAGGTGTCCTTTTGCAGGCAC
Linkage Group
6D / 2D
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
1.3
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09