Query (optional)   in Class  

GrainGenes Marker Report: F037

[ Printable Version ]  [ Submit comment/correction ]

Locus
F037
Type
RFLP
Map
Tt-Gill-6D431.6
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuF37
Possible Orthologs
ksuF37
XksuF37
XksuF37-6A
XksuF37-6B
XksuF37-6R



Probe for Locus
pTtksuF37
Locus
XksuF37-6A
[ Show all 9 ]
Type
Genomic
STS
PCR primers
R:CACAAAGACAAAGAACTAAT
L:TTCAGATTTTCACAGATTTA
Linkage Group
6D
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
0.9
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09