Query (optional)   in Class  

GrainGenes Marker Report: F041

[ Printable Version ]  [ Submit comment/correction ]

Locus
F041
Type
RFLP
Map
Tt-Gill-2D433.1
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuF41
Possible Orthologs
ksuF41
[ Show all 11 ]



Probe for Locus
pTtksuF41
Locus
XksuF41-2
[ Show all 13 ]
Type
Genomic
STS
PCR primers
R:TCTCCTAGCATAGCAGATGG
L:AGTCGTGTCGACTCGTCCAA
Polymorphism
KSUF41 EcoRV
[ Show all 6 ]
Linkage Group
2D / 2D
Insert Enzyme
PstI
Source Species
Triticum tauschii
Insert Size
0.9
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Image
KSUF41 SO autoradiogram
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09