Query (optional)   in Class  

GrainGenes Marker Report: F043a

[ Printable Version ]  [ Submit comment/correction ]

Locus
F043a
Type
RFLP
Map
Tt-Gill-6D100.2
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuF43
Possible Orthologs
F043b
[ Show all 18 ]



Probe for Locus
pTtksuF43
Locus
XksuF43-1B
[ Show all 22 ]
Type
Genomic
STS
PCR primers
R:TCCAAGATTCACCACTTTTT
L:ACGAGGTGCTCGACAAGTTC
Linkage Group
6D/4D,5D (2)
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
1.1
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
Gill, Bikram S.
Data Source
ATMI92.09
Gill, Bikram S.92.09