Query (optional)   in Class  

GrainGenes Marker Report: F048

[ Printable Version ]  [ Submit comment/correction ]

Locus
F048
Type
RFLP
Map
Tt-Gill-7D0
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuF48
Possible Orthologs
XksuF48
XksuF48-7A
XksuF48-7D



Probe for Locus
pTtksuF48
Locus
F048
XksuF48
XksuF48-7A
XksuF48-7D
Type
Genomic
STS
PCR primers
R:TTTATGGAAGCCATTATTAA
L:CATGTGTAGCGGGCTAGAGG
Insert Enzyme
PstI
Source Species
Triticum tauschii
Insert Size
0.7
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09