Query (optional)   in Class  

GrainGenes Marker Report: Fr-B2

[ Printable Version ]  [ Submit comment/correction ]

Locus
Fr-B2
Type
Trait
Chromosome
5B
Chromosome Arm
5BL
Map
Wheat-Composite2004-5B69
[ Show Nearby Loci ]
Species
Triticum aestivum
Probe
WMS639
Associated Gene
Fr-B2 (Triticum)
Gene Class
Frost resistance
Reference
ReferenceToth B et al. (2003) Mapping genes affecting flowering time and frost resistance on chromosome 5B of wheat Theoretical and Applied Genetics 107:509-514.
Data Source
Wheat Gene Catalogue
Remark
Trait marker Xgwm639-5B
Nearby marker on Composite map: Xgwm639.2
Position on Composite map estimated by GrainGenes.



Probe for Locus
WMS639
Locus
Xgwm639.1-5A
[ Show all 23 ]
Reference
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
General Remarks
Insert contains repeat (GA)19
PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER.
Type
PCR
SSR
PCR primers
5' CTCTCTCCATTCGGTTTTCC 3'
5' CATGCCCCCCTTTTCTG 3'
Amplification Conditions
3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 55 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism
WMS639
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
Data Source
Roeder, Marion S.98.09.15



Gene Associated with Locus
Fr-B2 (Triticum)
Gene Class
Frost resistance
Locus
Fr-B2
Reference
ReferenceToth B et al. (2003) Mapping genes affecting flowering time and frost resistance on chromosome 5B of wheat Theoretical and Applied Genetics 107:509-514.