Query (optional)   in Class  

GrainGenes Marker Report: G005

[ Printable Version ]  [ Submit comment/correction ]

Locus
G005
Type
RFLP
Map
Tt-Gill-2D270.5
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuG5
Possible Orthologs
[ Hide all but 1 of 7 ]
XksuG5
XksuG5-2
XksuG5-2A
XksuG5-2D
XksuG5a
XksuG5b
XksuG5c



Probe for Locus
pTtksuG5
Locus
XksuG5-2
[ Show all 16 ]
Type
Genomic
STS
PCR primers
R:AACAGAGCTTGATGTCTCAC
L:CAATACAACAGTTCAGGTGGC
Polymorphism
KSUG5 XbaI
Linkage Group
2D / 2D
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
1.5
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Image
KSUG5 SO autoradiogram
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09