Query (optional)   in Class  

GrainGenes Marker Report: G010

Locus
G010
Type
RFLP
Map
Tt-Gill-4D143.6
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuG10
Possible Orthologs
ksuG10
XksuG10
XksuG10-4B
XksuG10-4D
ksuG10-4B



Probe for Locus
pTtksuG10
Locus
ksuG10
[ Show all 7 ]
Reference
ReferenceGill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type
Genomic
STS
PCR primers
R:TGTCCAGCTTCAGCGAGTAC
L:GTGTTGATGTCCTTGAGGCC
Specificity
Primer specificity verified, maps on chromosomes 4A,4BL, 4DL.
Polymorphism
KSUG10 EcoRI
Linkage Group
4D
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
1.3
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Image
KSUG10 SO autoradiogram
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09