Query (optional)   in Class  

GrainGenes Marker Report: G012a

[ Printable Version ]  [ Submit comment/correction ]

Locus
G012a
Type
RFLP
Map
Tt-Gill-5D338.4
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuG12
Possible Orthologs
[ Hide all but 1 of 12 ]
G012b
XksuG12
XksuG12-4A
XksuG12-5B
XksuG12-6B
XksuG12-7A
XksuG12-7B
XksuG12a
XksuG12b
XksuG12c
ksuG12
ksuG12-7A



Probe for Locus
pTtksuG12
Locus
XksuG12-4A
[ Show all 17 ]
Type
Genomic
STS
PCR primers
R:TATACTTCTGAGCTGCCGAG
L:CCAGTGTTGTAGTTCTCTAT
Polymorphism
KSUG12 EcoRI
KSUG12 EcoRV
KSUG12 DraI
KSUG12 HindIII
KSUG12 XbaI
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Clone Vector
pUC18
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Image
KSUG12 SO autoradiogram
Data Source
Talbert, Luther E.94.09.12
Gill, Bikram S.92.09