Query (optional)   in Class  

GrainGenes Marker Report: G034

[ Printable Version ]  [ Submit comment/correction ]

Locus
G034
Probe
pTtksuG34
Possible Orthologs
XksuG34
XksuG34-1
XksuG34-1B
XksuG34-1D



Probe for Locus
pTtksuG34
Locus
[ Hide all but 1 of 14 ]
XksuG34-1
XksuG34-1B
XksuG34-1A
G034_1
G034_2
RI005K6
HD020D12
HD026P22
HD022H8
RI030I6
G034
XksuG34
XksuG34-1D
DGG34
Reference
ReferenceGill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type
Genomic
STS
PCR primers
R:GTCTCAGGAAGGTGATGATC
L:GAGCAGTAGGGTAAAGTAAG
Amplification Conditions
Anneal at 45oC
Polymorphism
KSUG34 EcoRI
Linkage Group
1D
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Source Tissue
leaf
Insert Size
0.9
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
Gill, Bikram S.
Image
KSUG34 SO autoradiogram
Data Source
Talbert, Luther E.95.07.06
ATMI92.09
Gill, Bikram S.92.09