Query (optional)   in Class  

GrainGenes Marker Report: G036

Locus
G036
Type
RFLP
Map
Tt-Gill-3D207.3
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuG36
Possible Orthologs
XksuG36
XksuG36-3D
ksuG36-3B



Probe for Locus
pTtksuG36
Locus
XksuG36-3D
XksuG36
G036
XksuG36-3B
Synonym
Other nameDG G36
ReferenceMa Z-Q et al. (1993) RFLP markers linked to two Hessian fly-resistance genes in wheat (Triticum aestivum L.) from Triticum tauschii (coss.) Schmal. Theoretical and Applied Genetics 85:750-754.
Type
Genomic
STS
PCR primers
R:GGACATTATCAGTTATCAGC
L:TGTCGCAACACTGTAGCACG
Specificity
Primer specificity verified, maps on chromosome 3BL.
Linkage Group
3D
Insert Enzyme
PstI
Source Species
Triticum tauschii
Insert Size
1.5
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09