Query (optional)   in Class  

GrainGenes Marker Report: G049a

[ Printable Version ]  [ Submit comment/correction ]

Locus
G049a
Type
RFLP
Map
Tt-Gill-b25.8
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuG49
Possible Orthologs
G049b
[ Show all 9 ]



Probe for Locus
pTtksuG49
Locus
[ Hide all but 1 of 12 ]
XksuG49-4A.2
XksuG49-4A.1
XksuG49-6A
XksuG49-7B
HI057N12
HI057O12
G049a
G049b
G049c
G049d
XksuG49
XksuG49b
Type
Genomic
STS
PCR primers
R:CTGCTTCTCACTTGTTCATC
L:TTTACCCTCTGGTCATTGTA
Linkage Group
2D (4)
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
1.9
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Data Source
Talbert, Luther E.94.09.12
ATMI92.09