Query (optional)   in Class  

GrainGenes Marker Report: G049a

[ Printable Version ]  [ Submit comment/correction ]

Locus
G049a
Type
RFLP
Map
Tt-Gill-b25.8
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuG49
Possible Orthologs
[ Hide all but 1 of 9 ]
G049b
G049c
G049d
XksuG49
XksuG49-4A.1
XksuG49-4A.2
XksuG49-6A
XksuG49-7B
XksuG49b



Probe for Locus
pTtksuG49
Locus
XksuG49-4A.2
[ Show all 12 ]
Type
Genomic
STS
PCR primers
R:CTGCTTCTCACTTGTTCATC
L:TTTACCCTCTGGTCATTGTA
Linkage Group
2D (4)
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
1.9
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Data Source
Talbert, Luther E.94.09.12
ATMI92.09