Query (optional)   in Class  

GrainGenes Marker Report: G062a

[ Printable Version ]  [ Submit comment/correction ]

Locus
G062a
Type
RFLP
Map
Tt-Gill-3D327.5
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuG62
Possible Orthologs
G062b
[ Show all 12 ]



Probe for Locus
pTtksuG62
Locus
[ Hide all but 1 of 15 ]
ksuG62
XksuG62-3B
XksuG62
RI043K7
D1.1_ctg7943
G062a
G062b
G062d
G062e
G062f
G062g
G062h
G062i
G062j
XksuG62-3R
Reference
ReferenceGill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type
Genomic
STS
PCR primers
L:TTAGAAGCAGGCTATGACCA
R:TACCATCAAGACGCCAGAAG
Linkage Group
3D (9)
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
0.7
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09