Query (optional)   in Class  

GrainGenes Marker Report: G062b

[ Printable Version ]  [ Submit comment/correction ]

Locus
G062b
Type
RFLP
Map
Tt-Gill-3D576.4
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuG62
Possible Orthologs
[ Hide all but 1 of 12 ]
G062a
G062d
G062e
G062f
G062g
G062h
G062i
G062j
ksuG62
XksuG62
XksuG62-3B
XksuG62-3R



Probe for Locus
pTtksuG62
Locus
ksuG62
[ Show all 15 ]
Reference
ReferenceGill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type
Genomic
STS
PCR primers
L:TTAGAAGCAGGCTATGACCA
R:TACCATCAAGACGCCAGAAG
Linkage Group
3D (9)
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
0.7
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09