Query (optional)   in Class  

GrainGenes Marker Report: G002

[ Printable Version ]  [ Submit comment/correction ]

Locus
G002
Type
RFLP
Map
Tt-Gill-1D236.2
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuG2
Possible Orthologs
XksuG2
XksuG2-1
XksuG2-1D
ksuG2
ksuG2-1D



Probe for Locus
pTtksuG2
Locus
XksuG2-1
[ Show all 11 ]
Type
Genomic
STS
PCR primers
R:CGATGTGCAGGTAAGAAGTT
L:CGGTAAGATGTAGTTGTGTA
Polymorphism
KSUG2 HindIII
Linkage Group
1D
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
0.6
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Image
KSUG2 SO autoradiogram
Data Source
Talbert, Luther E.94.09.12
ATMI92.09