Query (optional)   in Class  

GrainGenes Marker Report: G008

[ Printable Version ]  [ Submit comment/correction ]

Locus
G008
Type
RFLP
Map
Tt-Gill-6D156.1
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuG8
Possible Orthologs
XksuG8
XksuG8-6A
XksuG8-6B
XksuG8-6D
XksuG8a



Probe for Locus
pTtksuG8
Locus
XksuG8-6B
[ Show all 10 ]
Synonym
Other nameDG G8
ReferenceMa Z-Q et al. (1993) RFLP markers linked to two Hessian fly-resistance genes in wheat (Triticum aestivum L.) from Triticum tauschii (coss.) Schmal. Theoretical and Applied Genetics 85:750-754.
Type
Genomic
STS
PCR primers
R:ACCACAGAGTATTGGCTTGC
L:CCGTCGATTACTTGAGTAGAC
Specificity
Primer specificity verified, maps on chromosomes 6BS, 6DS.
Linkage Group
6D
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
1.3
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09