Query (optional)   in Class  

GrainGenes Marker Report: G009

[ Printable Version ]  [ Submit comment/correction ]

Locus
G009
Type
RFLP
Map
Tt-Gill-1D104.9
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuG9
Possible Orthologs
DGG9
[ Show all 9 ]



Probe for Locus
pTtksuG9
Locus
KSUG9
[ Show all 17 ]
Type
Genomic
STS
PCR primers
R:GAGCCTGATGAAGACATTAC
L:CGAGTTAAGTCCTTGTATCG
Polymorphism
KSUG9 EcoRI
Linkage Group
1D
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
1.4
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Image
KSUG9 SO autoradiogram
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09