Query (optional)   in Class  

GrainGenes Marker Report: G013

[ Printable Version ]  [ Submit comment/correction ]

Locus
G013
Type
RFLP
Map
Tt-Gill-3D208.7
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuG13
Possible Orthologs
XksuG13



Probe for Locus
pTtksuG13
Locus
XksuG13-3A
XksuG13
G013
Type
Genomic
STS
PCR primers
R:GCGGCAATCACCACTTTCAC
L:CTGGCAACAGGAACGACAGT
Insert Enzyme
PstI
Source Species
Triticum tauschii
Clone Vector
pUC18
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Data Source
Talbert, Luther E.94.09.12
Gill, Bikram S.92.09