Query (optional)   in Class  

GrainGenes Marker Report: G014

[ Printable Version ]  [ Submit comment/correction ]

Locus
G014
Type
RFLP
Map
Tt-Gill-5D536.2
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuG14
Possible Orthologs
XksuG14



Probe for Locus
pTtksuG14
Locus
XksuG14
G014
XksuG14.1
XksuG14.2
XKsuG14-5A
Reference
ReferenceGill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type
Genomic
STS
PCR primers
R:GGAGGCTATGGGTGCGTCAAC
L:AGCCCAACCTGTAAACAACAC
Insert Enzyme
PstI
Source Species
Triticum tauschii
Clone Vector
pUC18
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Data Source
Talbert, Luther E.94.09.12
Gill, Bikram S.92.09