Query (optional)   in Class  

GrainGenes Marker Report: G039

[ Printable Version ]  [ Submit comment/correction ]

Locus
G039
Type
RFLP
Map
Tt-Gill-7D290.7
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuG39
Possible Orthologs
XksuG39



Probe for Locus
pTtksuG39
Locus
RI029I6
G039
XksuG39
Type
Genomic
STS
PCR primers
R:GAACACGCATCATCATACCTG
L:CATCATCAAACGAATAACAAC
Linkage Group
7D
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
0.9
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09