Query (optional)   in Class  

GrainGenes Marker Report: G044

[ Printable Version ]  [ Submit comment/correction ]

Locus
G044
Type
RFLP
Map
Tt-Gill-5D195.6
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuG044
pTtksuG44
Possible Orthologs
XksuG44
XksuG44-5A
XksuG44-5B
XksuG44-5D
XksuG44-6D



Probe for Locus
pTtksuG044
Locus
G044
Type
Genomic
Insert Enzyme
PstI
Source Species
Triticum tauschii
Clone Vector
pUC18
Clone Location
Gill, Bikram S.
Data Source
Gill, Bikram S.92.09



Probe for Locus
pTtksuG44
Locus
XksuG44-6D
[ Show all 8 ]
Type
Genomic
STS
PCR primers
R:CAGCATTATACTGGACGATGC
L:GTACTGATCAAGTTCTGTCATCG
Specificity
Primer specificity verified, maps on chromosomes 5BL, 5DL.
Linkage Group
5D / 6DS
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
1
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Data Source
Talbert, Luther E.94.09.12
ATMI92.09