Query (optional)   in Class  

GrainGenes Marker Report: G053

[ Printable Version ]  [ Submit comment/correction ]

Locus
G053
Type
RFLP
Map
Tt-Gill-3D82.8
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuG53
Possible Orthologs
ksuG53
[ Show all 10 ]



Probe for Locus
pTtksuG53
Locus
XksuG53-3
[ Show all 15 ]
Type
Genomic
STS
PCR primers
R:CCAAATGACACAAACAACAT
L:GCTGGCAGAGAGAGATTGAG
Polymorphism
KSUG53 EcoRI
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
1.1
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Image
KSUG53 SO autoradiogram
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09