Query (optional)   in Class  

GrainGenes Marker Report: G059

[ Printable Version ]  [ Submit comment/correction ]

Locus
G059
Type
RFLP
Map
Tt-Gill-3D490.1
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuG59
Possible Orthologs
ksuG59
XksuG59
XksuG59-3
XksuG59-3D



Probe for Locus
pTtksuG59
Locus
ksuG59
[ Show all 9 ]
Reference
ReferenceGill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type
Genomic
STS
PCR primers
R:TGCGTATGTAATGTAGGACT
L:GGAAAATATAAAAATCAGAT
Polymorphism
KSUG59 EcoRI
Linkage Group
3D
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
0.9
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Image
KSUG59 SO autoradiogram
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09