Query (optional)   in Class  

GrainGenes Marker Report: Gb3

[ Printable Version ]  [ Submit comment/correction ]

Locus
Gb3
Type
Trait
Chromosome
7D
Chromosome Arm
7DL
Map
Wheat-Composite2004-7D231
[ Show Nearby Loci ]
2 Point Data
Gb3/Xwmc634Distance: 0 cM
Species
Triticum aestivum
Probe
WMS37
Associated Gene
Gb3 (Triticum)
Gene Class
Reaction to Schizaphis graminum Rond. (Toxoptera graminum Rond.)
Reference
ReferenceWeng Y et al. (2005) Microsatellite markers associated with two-derived greenbug resistance loci in wheat Theoretical and Applied Genetics 110:462-469.
Data Source
Wheat Gene Catalogue
Remark
Trait marker Xgwm37-7D
Nearby marker on Composite map: Xgwm37
Position on Composite map estimated by GrainGenes.



Probe for Locus
WMS37
Locus
Xgwm37-7D
[ Show all 8 ]
Reference
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
ReferenceRoeder MS et al. (1995) Abundance, variability and chromosomal location of microsatellites in wheat. Molecular and General Genetics 246:327-333.
General Remarks
Insert contains repeat (AG)8GG(AG)21
PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER.
Repeat type (AG)x8GG(AG)x21.
Product size 193 bp in Chinese Spring.
Type
PCR
SSR
PCR primers
5' ACTTCATTGTTGATCTTGCATG 3'
5' CGACGAATTCCCAGCTAAAC 3'
Amplification Conditions
3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 60 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism
WMS37
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
Data Source
Roeder, Marion S.98.09.15
Roeder, Marion S.94.10.17
Korzun, Victor N.97.10



Gene Associated with Locus
Gb3 (Triticum)
Gene Class
Reaction to Schizaphis graminum Rond. (Toxoptera graminum Rond.)
Pathology
Greenbug Damage
Locus
Gb3
Reference
ReferenceWeng Y et al. (2005) Microsatellite markers associated with two-derived greenbug resistance loci in wheat Theoretical and Applied Genetics 110:462-469.
ReferenceLazar MD et al. (1996) Registration of eight closely related wheat germplasm lines differing in biotype E greenbug resistance Crop Science 36:1419.
ReferenceTyler JM et al. (1987) Designations for genes in wheat germplasm conferring greenbug resistance. Crop Science 27:526-527.
ReferenceJoppa LR et al. (1980) Inheritance of resistance to greenbug toxicity in an amphiploid of Triticum turgidum/T. tauschii. Crop Science 20:343-344.
ReferenceWeng Y and Rudd JC MAS Wheat. Bringing Genomics to the Wheat Fields. Insect resistance. Greenbug MAS Wheat. Marker Assisted Selection in Wheat.
Chromosome
7D
ReferenceHollenhorst MM and Joppa LR (1983) Chromosomal location of genes for resistance to greenbug in 'Largo'and 'Amigo' wheats. Crop Science 23:91-93.
Germplasm
Hexaploid stockLARGO
ReferenceJoppa LR and Williams ND (1982) Registration of Largo, a greenbug resistant hexaploid wheat. Crop Science 22:901-902.
Info Source
ReferenceMcIntosh RA et al. (1995) Catalogue of gene symbols for wheat. Proceedings of the 8th International Wheat Genetics Symposium 1333-1500.
Data Curator
Hart, Gary E.95.08.24