Query (optional)   in Class  

GrainGenes Marker Report: H011

Locus
H011
Type
RFLP
Map Data
T.tauschii
Probe
pTtksuH11
Possible Orthologs
ksuH11
[ Show all 6 ]



Probe for Locus
pTtksuH11
Locus
XksuH11-6A
[ Show all 8 ]
Reference
ReferenceGill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type
Genomic
STS
PCR primers
R:GTAGCCGCTAATCTCGTCTGT
L:CGATCTCATAGCGAATATGT
Linkage Group
6D
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
1.8
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09