Query (optional)   in Class  

GrainGenes Marker Report: H22

Locus
H22
Type
Trait
Chromosome
1D
Chromosome Arm
1DS
Map
Wheat-Composite2004-1D9
[ Show Nearby Loci ]
Species
Triticum aestivum
Probe
GDM33
Associated Gene
H22 (Triticum)
Gene Class
Reaction to Mayetiola destructor (Say) (Phytophaga destructor) (Say)
Reference
ReferenceZhao HX et al. (2006) H22, a major resistance gene to the Hessian fly (Mayetiola destructor), is mapped to the distal region of wheat chromosome 1DS Theoretical and Applied Genetics 113:1491-1496.
Data Source
Matthews, David E.
Remark
Trait marker Xgdm33-1D
Nearby marker on Composite map: Xgdm33
Position on Composite map estimated by GrainGenes.



Probe for Locus
GDM33
Locus
Xgdm33-1D
[ Show all 8 ]
General Remarks
Repeat sequence: (CA)20
Repeat sequence: (CA)21
Type
PCR
SSR
PCR primers
Left GGCTCAATTCAACCGTTCTT
Right TACGTTCTGGTGGCTGCTC
Amplification Conditions
Tm = 60 C
Source Species
Aegilops tauschii



Gene Associated with Locus
H22 (Triticum)
Gene Class
Reaction to Mayetiola destructor (Say) (Phytophaga destructor) (Say)
Locus
H22
Reference
ReferenceMcIntosh RA et al. (1995) Catalogue of gene symbols for wheat. Proceedings of the 8th International Wheat Genetics Symposium 1333-1500.
ReferenceRaupp WJ et al. (1993) Chromosomal location of hessian fly-resistance genes H22, H23 and H24 derived from Triticum tauschii in the D genome of wheat. Journal of Heredity 84:142-145.
Chromosome
1D
ReferenceRaupp WJ et al. (1993) Chromosomal location of hessian fly-resistance genes H22, H23 and H24 derived from Triticum tauschii in the D genome of wheat. Journal of Heredity 84:142-145.
Germplasm
Hexaploid stockKS86WGRC1
ReferenceRaupp WJ et al. (1993) Chromosomal location of hessian fly-resistance genes H22, H23 and H24 derived from Triticum tauschii in the D genome of wheat. Journal of Heredity 84:142-145.
Info Source
ReferenceMcIntosh RA et al. (1995) Catalogue of gene symbols for wheat. Proceedings of the 8th International Wheat Genetics Symposium 1333-1500.
Data Curator
Hart, Gary E.95.08.24