Query (optional)   in Class  

GrainGenes Marker Report: H008b

[ Printable Version ]  [ Submit comment/correction ]

Locus
H008b
Type
RFLP
Map
Tt-Gill-5D124.5
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuH8
Possible Orthologs
H008a
[ Show all 9 ]



Probe for Locus
pTtksuH8
Locus
HD032L20
[ Show all 24 ]
Reference
ReferenceGill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type
Genomic
STS
PCR primers
L:GAGACCGTGCATCTTCATGT
R:GCATAGGTGTTCCCATCTGA
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Clone Vector
pUC18
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Data Source
Talbert, Luther E.94.09.12
Gill, Bikram S.92.09