Query (optional)   in Class  

GrainGenes Marker Report: H015

[ Printable Version ]  [ Submit comment/correction ]

Locus
H015
Type
RFLP
Map
Tt-Gill-3D315.5
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuH15
Possible Orthologs
XksuH15
XksuH15-3
XksuH15-3D



Probe for Locus
pTtksuH15
Locus
XksuH15-3
XksuH15-3D
XksuH15
H015
Type
Genomic
STS
PCR primers
R:CTTGCTTTGTTCTGTTTTGA
L:GAGCGTGGAGGAGAGGAGAT
Polymorphism
KSUH15 DraI
KSUH15 EcoRI
KSUH15 EcoRV
KSUH15 HindIII
KSUH15 XbaI
Linkage Group
3D
Insert Enzyme
PstI
Source Species
Triticum tauschii
Insert Size
1.8
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Image
KSUH15 SO autoradiogram
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09