Query (optional)   in Class  

GrainGenes Marker Report: H016

[ Printable Version ]  [ Submit comment/correction ]

Locus
H016
Type
RFLP
Map
Tt-Gill-2D457.3
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuH16
Possible Orthologs
ksuH16
[ Show all 7 ]



Probe for Locus
pTtksuH16
Locus
XksuH16
[ Show all 10 ]
Reference
ReferenceGill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type
Genomic
STS
PCR primers
R:CACCTTCTTCTTCTTCTACT
L:ACACTCTTCATTGGCATCTC
Polymorphism
KSUH16 EcoRV
[ Show all 6 ]
Linkage Group
2D
Insert Enzyme
PstI
Source Species
Triticum tauschii
Insert Size
0.4
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Image
KSUH16 SO autoradiogram
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09