Query (optional)   in Class  

GrainGenes Marker Report: H13

[ Printable Version ]  [ Submit comment/correction ]

Locus
H13
Type
Gene
Trait
Chromosome
6D
Chromosome Arm
6DL
6DS
Map
Triticum-Genes-6D46.4
Wheat-Composite2004-6D49
[ Show Nearby Loci ]
Map Data
Wheat genes
2 Point Data
Centromere/H13#1Distance: 35 cM
H13/H23#1Distance: 25 cM
Species
Triticum aestivum
Probe
CFD132
Associated Gene
H13 (Triticum)
Gene Class
Reaction to Mayetiola destructor (Say) (Phytophaga destructor) (Say)
Reference
ReferenceLiu X. et al. (2005) Hessian fly resistance gene H13 is mapped to a distal cluster of resistance genes in chromosome 6DS of wheat Theoretical and Applied Genetics 111:243-249.
ReferenceGill BS et al. (1987) Chromosomal mapping of Hessian fly resistance gene H13 in the D genome of wheat. Journal of Heredity 78:97-100.
Data Source
Matthews, David E.
Remark
Trait marker Xcfd132
Nearby marker on Composite map: Xcfd132
Position on Composite map estimated by GrainGenes.



Probe for Locus
CFD132
Locus
Xcfd132-6D
H13
Xcfd132
cfd132
Reference
ReferenceGuyomarc'h H et al. (2002) Characterisation of polymorphic microsatellite markers from Aegilops tauschii and transferability to the D-genome of bread wheat Theoretical and Applied Genetics 104:1164-1172.
General Remarks
Quality Score = B
Quality scores reflect the quality of amplification (from A very good quality to D multiple banding pattern : A and B can be used on capillary systems)
Amplifies motif: (CT)6(CA)19
Regularity of motif is perfect
Type
PCR
SSR
PCR primers
Forward 5' CAAATGCTAATCCCCGCC 3'
Reverse 5' TGTAAACAAGGTCGCAGGTG 3'
SSR size
150
Amplification Conditions
5 minutes at 94 degrees; 30 cycles (94 degrees for 30 seconds; 60 degrees for 30 seconds; 72 degrees for 30 seconds); 10 minutes at 72 degrees
Linkage Group
6D
Source Species
Aegilops tauschii
Data Source
Sourdille, Pierre



Gene Associated with Locus
H13 (Triticum)
Gene Class
Reaction to Mayetiola destructor (Say) (Phytophaga destructor) (Say)
Locus
H13
Reference
ReferencePatterson FL WGS-95-1333-Ref#778.
ReferenceOhm H et al. MAS Wheat. Bringing Genomics to the Wheat Fields. Insect resistance. Hessian Fly. Genes H9, H13, H25, H31 and Hdicoccum MAS Wheat. Marker Assisted Selection in Wheat.
Chromosome
6D
ReferenceGill BS et al. (1987) Chromosomal mapping of Hessian fly resistance gene H13 in the D genome of wheat. Journal of Heredity 78:97-100.
Chromosome Arm
6DL
ReferenceGill BS et al. (1987) Chromosomal mapping of Hessian fly resistance gene H13 in the D genome of wheat. Journal of Heredity 78:97-100.
Germplasm
Diploid stockKU 2076
Hexaploid stockKS81H1640HF
ReferenceGill BS et al. (1987) Chromosomal mapping of Hessian fly resistance gene H13 in the D genome of wheat. Journal of Heredity 78:97-100.
KU221-14
KU221-19
PI635054 (KS99WGRC42)
Info Source
ReferenceMcIntosh RA et al. (1995) Catalogue of gene symbols for wheat. Proceedings of the 8th International Wheat Genetics Symposium 1333-1500.
Data Curator
Hart, Gary E.95.08.24