Query (optional)   in Class  

GrainGenes Marker Report: I027

Locus
I027
Type
RFLP
Map
Tt-Gill-1D333.6
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuI27
Possible Orthologs
XksuI27
[ Show all 12 ]



Probe for Locus
pTtksuI27
Locus
XksuI27-1
[ Show all 17 ]
Type
Genomic
STS
PCR primers
R:GCACTTCCATATCGAGGTTG
L:GTACCATTGCTCAACTACAG
Polymorphism
KSUI27 DraI
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
1.9
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Image
KSUI27 SO autoradiogram
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09