Query (optional)   in Class  

GrainGenes Marker Report: I027

[ Printable Version ]  [ Submit comment/correction ]

Locus
I027
Type
RFLP
Map
Tt-Gill-1D333.6
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuI27
Possible Orthologs
XksuI27
[ Show all 12 ]



Probe for Locus
pTtksuI27
Locus
[ Hide all but 1 of 17 ]
XksuI27-1
XksuI27-1B
XksuI27-1D
XksuI27-1D.2
XksuI27-6B
XksuI27
HD013J2
D1.1_ctg5083
D1.1_ctg5083_1
D1.1_ctg5083_2
I027
XksuI27-1D.1
XksuI27a
XksuI27.1
ksuI27-1B
ksuI27-1D
ksuI27
Type
Genomic
STS
PCR primers
R:GCACTTCCATATCGAGGTTG
L:GTACCATTGCTCAACTACAG
Polymorphism
KSUI27 DraI
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
1.9
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Image
KSUI27 SO autoradiogram
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09