Query (optional)   in Class  

GrainGenes Marker Report: I026

[ Printable Version ]  [ Submit comment/correction ]

Locus
I026
Type
RFLP
Map
Tt-Gill-5D41.2
[ Show Nearby Loci ]
Map Data
T.tauschii
Probe
pTtksuI26
Possible Orthologs
XksuI26



Probe for Locus
pTtksuI26
Locus
XksuI26
I026
Type
Genomic
STS
PCR primers
R:GATCATGGCCAGACTTAGCT
L:ACGTCATGCGTGTATTGCCT
Linkage Group
5D
Insert Enzyme
PstI
Source Species
Triticum tauschii
Insert Size
2.6
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09