Query (optional)   in Class  

GrainGenes Marker Report: k00006

Locus
k00006
Type
Indel
Chromosome
5H
Map
Hv-HNxH602-5H214.7
[ Show Nearby Loci ]
Map Data
Barley, HN x H602, Sato2009
Species
Hordeum vulgare
Hordeum vulgare subsp. spontaneum
Probe
baak12f13
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remark
Dominant size polymorphism



Probe for Locus
baak12f13
Locus
k00006
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
General Remarks
Best BLAST Hit = ribose 5-phosphate isomerase-related [Arabidopsis thaliana] dbj BAB09159.1 unnamed protein product [Arabidopsis thaliana]
Type
PCR
PCR primers
Left 5' - ATAGGCAGAGAGACCAGGCA
Right 5' - ACGATACTTGGGGAAAGCCT
Sequence
BJ456216
PCR size
427