Query (optional)   in Class  

GrainGenes Marker Report: k00056

Locus
k00056
Type
SNP
Chromosome
3H
Map
Hv-HNxH602-3H136
[ Show Nearby Loci ]
Map Data
Barley, HN x H602, Sato2009
Species
Hordeum vulgare
Hordeum vulgare subsp. spontaneum
Probe
baak13c05
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remark
SNP = C/G
SNP structure (UNICODE) = GGAGGACGTGSAGATCATCCC
Parent 1 SNP sequence = GGAGGACGTGCAGATCATCCC
Parent 2 SNP sequence = GGAGGACGTGGAGATCATCCC



Probe for Locus
baak13c05
Locus
k00056
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
General Remarks
Best BLAST Hit = P0435B05.23 [Oryza sativa (japonica cultivar-group)] dbj BAB89544.1 P0435B05.23 [Oryza sativa (japonica cultivar-group)]
Type
PCR
PCR primers
Left 5' - GAAGCGAATACAGAGGACCG
Right 5' - GCTGCTCATGGTGCTACAAA
Sequence
AV911420
PCR size
403