Query (optional)   in Class  

GrainGenes Marker Report: k00086

[ Printable Version ]  [ Submit comment/correction ]

Locus
k00086
Type
SNP
Chromosome
2H
Map
Hv-HNxH602-2H125.4
[ Show Nearby Loci ]
Map Data
Barley, HN x H602, Sato2009
Species
Hordeum vulgare
Hordeum vulgare subsp. spontaneum
Probe
baak11j13
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remark
[ Hide all but 1 of 8 ]
SNP = C/T
SNP structure (UNICODE) = GATTGGCTGAYTCTTGCAAGG
Parent 1 SNP sequence = GATTGGCTGACTCTTGCAAGG
Parent 2 SNP sequence = GATTGGCTGATTCTTGCAAGG
SNP = G/A
SNP structure (UNICODE) = TTCCCTTCCTRTCACCGGTTC
Parent 1 SNP sequence = TTCCCTTCCTGTCACCGGTTC
Parent 2 SNP sequence = TTCCCTTCCTATCACCGGTTC



Probe for Locus
baak11j13
Locus
k00086
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
General Remarks
Best BLAST Hit = probable transcription repressor HOTR - barley emb CAA04677.1 putative transcription repressor HOTR [Hordeum vulgare subsp.
Type
PCR
PCR primers
Left 5' - GACACGGCAGCAAACAAGTA
Right 5' - CGGTAAGACAGAGCCGCTAC
Sequence
AV910983
PCR size
366