Query (optional)   in Class  

GrainGenes Marker Report: ksuG59

[ Printable Version ]  [ Submit comment/correction ]

Locus
ksuG59
Type
RFLP
Synonym
SynonympTtksuG59
Chromosome
3H
Chromosome Arm
3HL
Map
Barley-Consensus-3H18.7
[ Show all 8 ]
[ Show Nearby Loci ]
Map Data
3B Physical
[ Show all 8 ]
Probe
pTtksuG59
Reference
ReferenceRostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source
Kleinhofs, Andris
Remark
This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin
Possible Orthologs
G059
XksuG59
XksuG59-3
XksuG59-3D



Probe for Locus
pTtksuG59
Locus
[ Hide all but 1 of 9 ]
ksuG59
XksuG59-3
XksuG59-3D
HI081F2
HD081F2
D1.1_ctg5041
G059
XksuG59
XksuG59-3R
Reference
ReferenceGill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type
Genomic
STS
PCR primers
R:TGCGTATGTAATGTAGGACT
L:GGAAAATATAAAAATCAGAT
Polymorphism
KSUG59 EcoRI
Linkage Group
3D
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
0.9
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Image
KSUG59 SO autoradiogram
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09