Query (optional)   in Class  

GrainGenes Marker Report: KSUG9

[ Printable Version ]  [ Submit comment/correction ]

Locus
KSUG9
Type
RFLP
Map
1D.1R recombinants55.5
Hordeum-Bins-1H34
Oat-2016-Consensus-129.2
Oat-2018-Consensus_Mrg129.2
Oat-OxT-829.4
[ Show Nearby Loci ]
Rearrangement
In segmentI93
[ Show all 6 ]
Map Data
Barley, BinMap 2005
Oat, OxT
Oat-2016-Consensus
Oat-2018-Consensus
Wheat.Rye recombinant
Species
Avena sativa
Probe
pTtksuG9
Data Source
Kleinhofs, Andris
Remark
This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin
Possible Orthologs
DGG9
[ Show all 9 ]



Probe for Locus
pTtksuG9
Locus
KSUG9
[ Show all 17 ]
Type
Genomic
STS
PCR primers
R:GAGCCTGATGAAGACATTAC
L:CGAGTTAAGTCCTTGTATCG
Polymorphism
KSUG9 EcoRI
Linkage Group
1D
Insert Enzyme
PstI
Source Species
Triticum aestivum
Triticum tauschii
Insert Size
1.4
Clone Vector
pUC18
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Image
KSUG9 SO autoradiogram
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Gill, Bikram S.92.09